b4etham0elavictobo b4etham0elavictobo

18-11-2015
English

contestada

Match each of the time prefixes with its meaning.
A. super-
above
B. sub-
_far
C. tele-
under
D. tran-
_across

Respuesta :

WorldlyGlass49 WorldlyGlass49

18-11-2015

Super - above, sub - under, tele - far, tran - across.

Answer Link

Otras preguntas

What is the easiest to use to solve x2-6=0?

Did I get the right answers??

Segment HK is 24 inches long. How long is segment HL ? A. 48 in. B. 24 in. C. 12 in. D. 6 in.

Which equation represents a football player who runs 5 yds/sec and starts on the 25 yard line? y = 5x + 25 y = 5x - 25 y = 25x + 5 y = 25x - 5

How does the water cycle ensure that we have water?

Mary picks 15 flowers from her garden. If 3 out of 5 of these flowers are yellow, how many yellow flowers does Mary pick?

The study of the human muscles

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

How much is 10% of $105.00?

what does undulate mean?