hdiaz931 hdiaz931

22-02-2017
Biology

contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321

23-02-2017

RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU

Answer Link

Otras preguntas

if 300 word was equal to 5 points how many points does 150 words equal

Many fifteenth and sixteenth century Europeans collected non-Western objects like the Sapi-Portuguese saltcellar (c. 1490-1530). How can we problematize occiden

An article cost rs 190 what is the cost of 13 such articles.

In which culture were slaves allowed to earn a. Living

What type of outside source does MacGregor use in this excerpt? college textbook magazine article musical lyrics historical website

Find a point-slope form for the line with slope 1/5 and passing through the point (-2,-1)

What advice would you give Malcolm and Macduff? Why?

This is about the law of conservation of energy and work/energy. What force prevents 100% of the energy in a system from being used to do work?

please help quickly !!!

ANSWER THIS QUESTION! PLEASEE litterally no one responds, and I kidna want answers I'm thinking of making a new anime series. If you are good at anime-making, h