miahkunz2000 miahkunz2000

17-11-2017
History

contestada

Which characteristic allowed European universities to play a major role in launching the scientific revolution?

Respuesta :

nadizzle nadizzle

17-11-2017

Their independence from government and church control.

Answer Link

Otras preguntas

Scientists are experimenting with a kind of gun that may eventually be used to fire payloads directly into orbit. In one test, this gun accelerates a 5.0 kg pro

Help me please,Thanks

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Plutonic and volcanic rocks are the two basic types of a. mafic rocks. b. igneous rocks. c. sedimentary rocks. d. metamorphic rocks.

Which of the following changes would produce the greatest change in total peripheral resistance?

What point of view does Emily Brontë use in this excerpt from the novel Wuthering Heights? In all England, I do not believe that I could have fixed on a situat

A 0.100-kilogram apple falls from a height of 1.50 meters to 1.00 meter. Ignoring frictional effects, the total mechanical energy of the apple at this height i

PLEASE HELP Fill in the missing terms of the arithmetic sequence. -7, __, 1, 5, __, 13 -3, 10 -4, 10 -4, 9 -3, 9

What is the range of the function y = |x |? x ≥ 0 y ≥ 0 all real numbers

Explain how you could use a model to find the quotient. 4 divided by 1/3