shamikahayes30 shamikahayes30
  • 21-03-2022
  • English
contestada

which sentence combines information

Respuesta :

lo81260
lo81260 lo81260
  • 21-03-2022

Answer:i gunna need more info

Explanation:

Answer Link
michealacheaw
michealacheaw michealacheaw
  • 21-03-2022

there are many worlds that are used to join sentence example and,but and many nore

Answer Link

Otras preguntas

A customer wanted to purchase a video game and realized that they were short $4.28 to be able to pay. Which value is the opposite of being short $4.28? $4.28 $
The ratio a: b is 2 : 3 and the ratio b : c is 5: 4. Write the ratio a: b:c in its simplest form.​
What the invisible hand ensures that economic prosperity is distributed equally?
when a society gets the most it can from its scarce resources
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
2 Global annual land mean precipitation showed a small upward trend over the twentieth century of approximately 1.1 mm per decade. At this rate, an overall incr
Which is the equation of the vertical line that passes through (- 4 3?
In circle Y, what is m1?
15 ile 600 arasındaki tam sayılardan kaç tanesi 3 veya 5 ile tam bölünür?
Since PQRS is a rhombus,