marandajane marandajane

19-01-2023
Biology

contestada

Transribe and translate the following dna strand
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Respuesta :

Otras preguntas

A _____ Impact area is an impact area that is permanently designated within the training complex and used indefinitely to contain fired or launched ammunition a

The point P = (x, -3/4) lies on the unit circle shown below. What is the value of x in simplest form?

in this experiment, if, say 20 kg are placed on the left side, can the plank be balanced with only 10 kg on the right side?a. Yesb. No

2. A tyre contain air of a guage pressure of 5.0*10⁴ at 30.0°c .at night,the temperature drops to 10.0°c.find the new guage pressure in other tyre

What is the correct question tag for It is strange?

In Design phase, which is the primary area of concern ?(a) Architecture(b) Data(c) Interface(d) All of the mentioned

Instinct approaches to motivation have faded because they lacked the goal of __________ of psychology. Select one: a. Description b. Explanation c. Prediction d

For men, the period of physical and psychological change in the reproductive system is referred to asa) male climacteric.b) testosterone lowering.c) male menopa

Which of the following represents the basic principles of the binding change mechanism as they pertain to ATP synthase? a) Conformational changes in α, β, γ sub

How was Emperor Augustus involved in the works of Vergil and Horace?