2007chengeric 2007chengeric
  • 17-03-2022
  • Chemistry
contestada

Is mg2sio4 ionic?
Please help me

Respuesta :

with1008
with1008 with1008
  • 17-03-2022

Answer:

yes it it

Explanation:

Magnesium ion and silicate 2:1.

Answer Link

Otras preguntas

Which step to transform Turkish life was not taken by its leader after Turkey gained its independence? O changing the Turkish alphabet to Latin letters O creati
What type of painting was popular during the Renaissance because of the interest in people due to Humanism as seen in the Mona Lisa and Botticelli painting? A.p
& & & 50 cm3 of a gas are in 20°C calculate the new volume at 96°C
What example of figurative langue is this line? Wolf huffed and puffed and blew and blew 1.alliteration 2.irony 3.personification 4. onomatopoeia
Geometry...Please help as soon as possible please and Thank you!!!
Match the following1)Prime meridian- hottest region2)equator-green wich3)torrid zone-poles4)axis_great circle​
What is the major difference between primary and secondary succession? Group of answer choices Primary succession always occurs before secondary succession. Sec
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Pls help me it’s due tonight
2 3 4 5 6 7 8 9 10 TIME REMAINING 01:27:25 Read the excerpt below from “The Story of an Hour” by Kate Chopin and answer the question that follows. She wept at