figueroamelany316 figueroamelany316
  • 19-12-2020
  • Biology
contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160
raduoprea160 raduoprea160
  • 19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

I really need help !!
"at the clearing house, bank x has $300 in checks drawn on bank y and bank y has $200 in checks drawn on bank x. how does the clearinghouse settle the accounts.
Yoon Ki investigates electromagnetic induction by moving a bar magnet into a coil of wire. His experimental setup is shown. What change would most improve hi
What happens when someone places an ice pack on an sprained ankle
Which theme does not summarize the major developments of the 20th century? A. Decolonization and nationalism B. Globalization C. Long term international peace
PLS ANSWER THIS TY ty ty
What is the value of 1 in the number 450.731? A. 0.0001 B. 0.001 C 0.01 D 1
The etruscans were highly civilized people who excelled in all of the following except
What adaptations does this plant have to thrive in a dry, arid climate
Malia is observing the velocity of a cyclist at different times. After two hours, the velocity of the cyclist is 15 km/h. After five hours, the velocity of the