janmarioacosta janmarioacosta
  • 16-08-2021
  • Mathematics
contestada

Gabriel was at the gym for 3/4 hours. He spent 1/2 of this time shooting baskets. What fraction of an hour did Gabriel spend shoot baskets?

Respuesta :

Nephele
Nephele Nephele
  • 16-08-2021

Answer:

1/2×3/4=3/8h

3/8×8/8=

3/8h

Answer Link

Otras preguntas

In which type of economic system are all productive activities privately owned Mcq?
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
solve the inequality
After a student has been confirmed to start a test, the student's computer stays on the screen reading "Please wait for the proctor to confirm your information"
Which leader was most influenced by Marxist ideology? answer choices. A. Adolf Hitler. B. David Lloyd George. C. V.I. Lenin. D. Woodrow Wilson.
mary has 200 ml of hand sanitizer that is 15% alcohol she mixes it with 200 ml of a hand sanitizer that is x% alcohol. how many milliliters of pure alcohol is i
What rule in the Code of Chivalry, did Sir Gawain break and cause the Green Knight to mock him? * Thou shalt respect all weaknesses, and shalt constitute thyse
what are the two solutions to the following absolute value? |2x-4|=6 show your work
Your movement is done by a pair of ____ working together. When one muscle contracts ____ the other.
Describe the structure and makeup of DNA.