saraheat18 saraheat18

18-03-2021
English

contestada

when she sees food her eyes start to spin

is this an example of imagery?
PLEASE HELP

Respuesta :

kaylafromwashington5 kaylafromwashington5

18-03-2021

Answer:

Yes it is!

Explanation:

Answer Link

scorpio7 scorpio7

18-03-2021

Yes it is an imagery

Answer Link

Otras preguntas

Item 4 Pete wants to mix 4 quarts of 20% orange juice concentrate with some 60% pineapple juice concentrate to get a 50% punch concentrate for a party. How much

when was pokemon movie 2000 release

The term performance quality refers to: Multiple Choice Customer satisfaction with the total experience of a product or service. The gap between product design

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Olivia lives in a house that is 9 meters below sea level. Olivia goes to school every day, which is 5 meters above sea level. How many meters does Olivia travel

what is the answer to the question?

The angle of elevation of a cloud from a point 60m above a lake is 30" and the angle ofdepression of the reflection of the cloud in the lake is 60° find the hei

Find the value of the expression 30 - 3^2, 3 + 8(2),

A.f(x)=-3/4x+10 B.f(x)=3/4x-10 C.f(x)=4/3x+10 D.f(x)=-4/3x-10

whats the value of the expression below 36÷([tex]\frac{2^{5} }{8}[/tex])+7x(3+11)?