angiesanchezgalvez24 angiesanchezgalvez24

19-02-2021
History

contestada

HELP

how was the Union able to “win” The Civil War. briefly discuss at least 3 determining factors that lead to the union’s military victory over there Confederacy.

Respuesta :

kilarkent17 kilarkent17

19-02-2021

Answer:

Three determine factors are:

1. Industry in the north

2. more resources in the union

3. more railway in the north

other small factors: manpower, motivation and naval superiority

Answer Link

Otras preguntas

1D. In the Lesson Opener, William Maclay observes that President Washington felt nervous and uncomfortable delivering his inauguration speech. Were you surprise

From Brown Girl Dreaming (a) identify one example of a private thought or feeling Woodson shares in her memoir

In kite WXYZ, m m 4 W Z

What is the “real price” of a good or service in the wealth of nations?

what is one commonality among all consumer services jobs

Sociologist make a distinction between norms and values. How are the concepts different? Support your answer with examples.

Which angle in a 30 60 90 triangle is opposite of the hypothesis?

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

16 over 10 = n + 2 over 5

To indirectly measure the distance across a river, Carson stands on one side of the river and uses sight- lines to landmark on the opposite bank. Carson draws t