bcastillo2341 bcastillo2341

18-11-2020
History

contestada

Can you help me I dont get it (pls explain how to do it if not its ok)

Can you help me I dont get it pls explain how to do it if not its ok class=

Respuesta :

alexagallegos2019 alexagallegos2019

18-11-2020

Answer:

2 and 14

Explanation:

21/6=3.5

7/3.5=2

4*3.5=14

7:2

14:4

Answer Link

Otras preguntas

If malaria were eliminated from a certain area, how do you think the frequency of the sickle cell allele in that area would change

Estimate: 92% of 104

Healthy and long-lasting weight loss involves _________ changes.

Find all solution to the equation below for 0 -2sin(a)=1

A typical baroque operatic form was the da capo aria in aba form in which the singer

A car slams on its brakes, coming to a complete stop in 4.0 s. The car was traveling south at 60.0 mph. Calculate the acceleration.

What short-term effect does alcohol have on the body? A. It increases the heart rate. B. It causes blood vessels to enlarge. C. It can ca

Need help plz answer correctly Will mark brainlest What decimal is equal to 40%. 0.04% 0.4% 4 400 What fraction is equal to the decimal 0.8 In simplest f

A scatter plot has been created with a line of best fit that matches the equation y=11x+340. Using this line of best fit, determine the output value when the in

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3