brooklynzen4485 brooklynzen4485

18-05-2023
Physics

contestada

what is the wavelength of a 1.0 mhzmhz ultrasound wave traveling through aluminum? express your answer to two significant figures and include the appropriate units.

Respuesta :

Otras preguntas

Let S={v1,v2,v3} be a linearly independent set of vectors in . Determine whether T={2 v1+ v2 - 2 v3, 4v1+ 3v2 ,3 v1+ 2 v2- v3} is linearly independent.

In the essay box below, submit any observations you made, as well as the answers to the questions above. Then write a summary paragraph describing the effects o

Given the relationship in the table, what is the value of h(3) multiplied by h(7)??? P.S. I will give brainliest to the correct answer

10 increased by the quotient of a number and six is five

Darryl mixed 4 cups of white paint with 6 cups of red paint but didn't have enough to finish painting his wall how much would he need to add to 1 cup of white p

Simplify the polynomials -71uv^2u+(3vu^2v-5u^6u^2v^4)+3u^3v^2v^2u^5

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Should I be a teacher or lawyer when I get a job? Why please

connect them together please

What acts of kindness do Barbara and the other waitresses do for their customers? In nickel and dime?