babypineapple1 babypineapple1
  • 21-03-2017
  • Mathematics
contestada

Angles A and B are complementary.


What is the value of x?

34
56
68
79

Respuesta :

HomertheGenius
HomertheGenius HomertheGenius
  • 31-03-2017
Angle A = x + 22°.
Angle B = x.
And since the angles are complementary:
A + B = 90°
x + 22° + x = 90°
2 x + 22° = 90°
2 x = 90° - 22°
2 x = 68°
x = 68° : 2
x = 34°
Angle A = 56°, angle B = 34°
Answer : The value of x is A ) 34°.
Answer Link
SeanWoods55 SeanWoods55
  • 21-05-2020

Answer:

34

Step-by-step explanation:

Answer Link

Otras preguntas

Fellow citizens, pardon me, and allow me to ask, why am I called upon to speak here today? What have I or those I represent to do with your national independenc
Which type of law governs the relationship between private individuals or companies?
Jose gets up from his seat on the bus to move closer to the front. Just as he begins to walk forward, the bus stops at a light. What is the best explanation of
what 12×15??????????and don't forget to put # sammy7609
What is sustains agriculture
What are culture traits?
why did U.S. help overthrow Guetamolean President Guzman in early 1950's
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
This question is asking to label the following cells. One should be an animal and the other should be a plant. Please help me, I will be glad if you do! ~Aurora
what temperature will Windex freeze at?