kaelan666 kaelan666
  • 20-09-2021
  • Mathematics
contestada

Need help with this math

Need help with this math class=

Respuesta :

Shaunneedstoknow
Shaunneedstoknow Shaunneedstoknow
  • 20-09-2021

43112

its a random number

Answer Link

Otras preguntas

What percent of 642 is 321? and can you please add steps on how you got that answer thanks!
Rewrite the following linear equation in slope-intercept form. Write your answer with no spaces. y+4=-2(x-1)
What’s the answer to this question
Why was a system of checks and balances built into the constitution?
PLEASE HELP ASAP Écris la forme correcte de rire. Je. . Écris la forme correcte de rire. Nous . Écris la forme correcte de rire. Il .
A car dealer had 12 red cars on his lot at the beginning of the month. the first week he sold 8 of them. What fraction did he sell?
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
How does the Mexican ambassador react to Roosevelt corollary
Theodore works for Mr. Jones. Mr. Jones agreed to start Theodore at $.01 the first day, $.02 the second day, $.04 the third day, $.08 the fourth day, and so on.
Stimulants may be used to treat