prettygirls12 prettygirls12
  • 20-08-2021
  • Mathematics
contestada

Can somebody please help me?

Can somebody please help me class=

Respuesta :

einsteinmusfirah einsteinmusfirah
  • 20-08-2021

Answer:

Second option,domain:  negative infinity, 4 and range, negative infinity, 3

The domain are all the x's that you can input into a function. It looks like the function goes to all x's from negative infinity until it hits positive 4. that's why it is -infinity, 4 for the domain.

The range is all the y's that are outputted. As you can see, the function goes to all y's from negative infinity to 3.

Step-by-step explanation:

Answer Link

Otras preguntas

What is the primary learning modality of a child who learns best by looking at books and pictures? a. tactile b. auditory c. visual d. kinesthetic
Mr .Johnson works 80 hours each pay period. His salary is $20 per hour. How much money does he earn in 10 pay periods? A-$160,000 B-$16,000 C-$1,600 D-$160
Which number is great 20% or 0.02
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Which of the following statements would be the process that is used to describe solving a system of equation with 6 variables? Solving a 3 order system Solving
Write 2x+5y=10 in slope-intercept form
a que hora ,ustedes al estadio
Your research focus will: be general at first but become more specific not be known to the reader be specific at first but become more general change throughout
Why are bathroom tiles usually rough
A triangle with all sides of equal length is a/an _______ triangle.