galcrystal78 galcrystal78
  • 19-04-2021
  • English
contestada

what is the meaning of tepid?

Respuesta :

jewelzze
jewelzze jewelzze
  • 19-04-2021

Answer:

only slightly warm/ lukewarm

Answer Link
zoestout247
zoestout247 zoestout247
  • 19-04-2021

Answer:

(especially of a liquid) only slightly warm; lukewarm.

Answer Link

Otras preguntas

If there are 1500 guests expected this weekend how many can we expect will revive free admission
what is the puepose of setting a deadline for a goal
What help is Kindred willing to offer Everyman instead of going along himself? Quote the line in the poem exactly
The gland that is primarily responsible for regulating metabolism is indicated by ________.
Anybody have the correct answer for me?
In “The Prologue” to The Canterbury Tales, Chaucer calls the Franklin’s girdle “white as morning milk” to a. reiterate the Franklin’s obsession with food. b.
The quotient of 2x-1 and 3x +5
What rock type does the principle of superposition apply to and how is the principle of superposition used to study the history of life on Earth?
The eggs of seed plants are fertilized within ovules, and the ovules then develop into _____.
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’