deahnabray deahnabray

20-01-2021
Mathematics

contestada

Order these numbers from least to greatest.
8.07, 8.5062, 8.5, 8.007

Respuesta :

marygraceleathe marygraceleathe

20-01-2021

Answer: (8.007, 8.07, 8.5, 8.5062)

Step-by-step explanation:

Answer Link

kallmeseyvn kallmeseyvn

20-01-2021

i believe it’s 8.007, 8.562, 8.07, 8.5

Answer Link

Otras preguntas

plz answer asap thank you stay safe!!! One type of fiber that is not digested as it travels through the digestive system is __________________.

PLZ HELP! WILL GIVE BRAINLIEST!

The number of waves that pass through a fixed point per second is the ________of the wave

In the 1960 American men had to register for the draft if they were between the ages of?

What is the answer for this? (THE ANSWER CAN BE MORE THAN ONE-IT CAN BE ONE, TWO, or ALL)

Which country was the last to join the Allied Powers? Great Britain France United States China

Read the excerpt from A History of the World in 100 Objects. This thinning would materially change the sound of the drum, evidence that although it might contin

Which innovation in transportation connected the Northeast to the Mid- West by creating a "boat highway"? * A.Bessemer Steel Process B.Railroads C.steamboats D.

which statement is true

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d