appemmoboom appemmoboom
  • 20-10-2020
  • History
contestada

How did Hammurabi differentiate his laws?
A. The laws did not distinguish, all were treated equally
B. Based on races
C. Based on social class
D. Based on religion

Respuesta :

niawatson2007
niawatson2007 niawatson2007
  • 20-10-2020

Answer:

C

Explanation:

Answer Link
voidbroly
voidbroly voidbroly
  • 20-10-2020
Answer is C. Based on social class
Answer Link

Otras preguntas

What is a theme? the conclusion of the story a category of literature the writer’s autobiography the central message in a literary work
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Please someone helo me
How do you answer this
What two trends are commonly seen in modern monthly co2 concentration charts??
Which statement about a chemical reaction is true? It occurs only at low temperatures. It occurs only at high temperatures. It occurs whenever a physical change
What is the term meaning individual companies have control of a country's natural resources?
who was king Philip and did he do
Need help ASAP Algebra
Any helmet should fit loosely on your head and should tilt backward or forward. True False