noahaceja
noahaceja noahaceja
  • 16-10-2020
  • Mathematics
contestada

Is the following relation a function?

Is the following relation a function class=

Respuesta :

1673892
1673892 1673892
  • 16-10-2020

Answer:

Yes

Step-by-step explanation:

Answer Link
paolamendoza5 paolamendoza5
  • 16-10-2020

Answer:

no

Step-by-step explanation:

Answer Link

Otras preguntas

What is he justness of Allah in making fasting obligatory​
Rectangle A'B'C'D'is the image of rectangle ABCD after it has been translated according to the rule T-43(x, y). Which points are vertices of the pre-image, rect
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
When more firms produce the same product, it means that of that product is produced at a quality
Which is part of the nonspecific immune response? O A. Fever O B. B cells O C. Lymphocytes O D. Making antibodies
Why is the use of iodised salt advisable?
Can someone plz check over my answers. It's urgent, thx!
The Freedmen’s Bureau in Georgia helped
_____ a sequence in which a fixed amount is added on to get the next term
What is the lithosphere?