cadinperes
cadinperes cadinperes
  • 17-09-2020
  • Mathematics
contestada

Which mixed number is equivalent to the improper fraction 23/6?

A.3 1/6

B.3 5/6

C.3 1/2

D.2 1/2

Respuesta :

micahhillcreati
micahhillcreati micahhillcreati
  • 17-09-2020

Answer:

B.3 5/6

Step-by-step explanation:

Hope this helps!

Answer Link
matthew9283
matthew9283 matthew9283
  • 17-09-2020
The answer to this is 3 5/6
Answer Link

Otras preguntas

How many moles are equal to 9.03x10^24 molecules of water (H20)?
P+6/6+m*n; use m = 4, n = - 1, and p = -6 help plz i dont want to fail
prove the two triangles congruent. sas sss asa aas hl not congruent
Can someone tell me ideas how violence affects Life or tell me how it affects ur daily life
(-2x2 -5x) + (2x2 +4x +3) w solutions :(
Solve for the missing side to the nearest tenth. 16 30 X =
Use the restriction enzyme EcoRi to cut DNA Victim DNA : GGAAG ATTCTACATTACTGACGGACGTGACGTGA CCTTCTTAA GATGTAATGACTGCCTGCACTGACT Number of restriction fragmen
Paul and Ivan are riding a tandem bike together they're moving at a speed of 5 meters per second Paul and Ivan each have a mass of 50 kg what can I do to increa
6. A trail is 13.5 miles long. There are markers every 0.25 mile along the trail, including at the end of the trail. How many markers are there in all? a) 4 b)
Match each letter on the left to box on right, need help