devinlj07 devinlj07

18-12-2019
Mathematics

contestada

Simplify. 3x+8−x−6 Enter your answer in the box.

Respuesta :

squishy45 squishy45

18-12-2019

Answer: 52x

Explanation

Answer Link

Otras preguntas

Which is cheaper for a $56 item that cost $9.25 to ship. A 15% coupon off the cost of the item or free shipping

Why did the plantation owners begin to import African slaves to work in their farms? A. They believed Africans would be more loyal to them because they were fro

in a particular class of 23 students, 18 are men. what fraction of the students in the class are men?k

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

14% of 81 is what number

completely factor the expression 27x^6-y^3

Which graph is the graph of y=⌈x⌉ over the domain 3≤x≤6 ? (Graphs below)

What factors limit the impact of the mass media on American Politics?

Which statement about tobacco use is true? Smokeless tobacco can lead to cancer but is not addictive. Smoking relaxes people because it lowers the heart rate. S

multiple choice Craig wants to use an elevator to carry identical packages having the same weight. Each package weighs 4 pounds and Craig weighs 90 pounds. If