kariukixavier kariukixavier

17-08-2018
Chemistry

contestada

when measuring the volume of an irregularly shaped object you would measure the amount of water____ or pushed away
18 points

Respuesta :

helllllloooo helllllloooo

18-08-2018

Displacement is the answer

Answer Link

Otras preguntas

The First Party System refers to the period during George Washington's presidency when political parties first emerged in the United States. This resulted from

Technological improvements have allowed people to inhabit a wider variety of places more easily.

Find the perimeter of the larger pentagon if the two pentagons are similar.

What volume of oxygen gas is released at STP if 10.0 g of potassium chlorate is decomposed? (The molar mass of KClO3 is 122.55 g/mol.)

what's the ratio 6kg : 150g

* Imagine that you are shown four wooden toys: a red triangle, a blue triangle, a red circle, and a blue circle. A toy that has exactly ONE of the following tr

Which BEST determines the author's purpose? A) Thoreau's quote expresses the significance of a life filled with music. B) Thoreau quote expresses that individ

Although advertising is used mostly by business firms, a wide range of not-for-profit organizations, professionals, and social agencies also use advertising

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

why do you think latin music had such a great influence on the development of popular music?