queeenbre8066 queeenbre8066

18-05-2018
Social Studies

contestada

Time line of how did Muslims came to rule Spain?

Respuesta :

vdnjlkhs vdnjlkhs

18-05-2018

The Muslims came from the Vikings. The vikings, they built up the Moors. Then the Moor,s they crossed into the Iberian peninsula and took over Iberia.

Answer Link

Otras preguntas

Andres uses mental mrh and his knowledge of multiplication to solve 167 ÷ 8. Andre knows that 8 x 20=160. Andre then subtracts 167 - 160=7. How can Andre use t

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

If a company makes products entirely out of plastic? Could it still be eco- friendly? Why or why not?

Conceptions occur when a male's sperm implants into a female's egg. The fertilized egg is then known as a(n)_________. A. fetus B. blastocyst C. embryo D. Zygot

How do you answer this

all of the following are risk factors for alcoholism except age? genetics? ethnicity? risk taking personality?

Creating nuclear energy produces large amounts of radioactive waste. true or false.

Which chemical equation describes the balanced reaction synthesizing copper and oxygen into copper oxide? A. Cu + O2 → CuO B. 2Cu + O2 → 2CuO C. Cu

my granddaughter is having problems understanding math questions; Divide 360 / 4

“Maintain a 3.0” is an example of a ______________. a. group norm b. team rule c. group rule d. team norm