Baecool2790 Baecool2790
  • 20-03-2024
  • Computers and Technology
contestada

Cameron concludes a routine request with the statement​ "Let me know if there is anything else I can do to assist​ you." This statement is an example of a​ _______________.
A) Closing remark
B) Invitation for further assistance
C) Courtesy gesture
D) Formality

Respuesta :

Otras preguntas

Which question is grammatically correct? A. Quién son de Ecuador? B. Quienes son de Ecuador? C. ¿Quiénes son de Ecuador? D. ¿Quien son de Ecuador?
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Describe the energy transformations that occur when a piece of wood is burned
Suzanne bought 50 apples at the orchard. She bought 4 times as many red apples as green apple. How many more red apples then green apples did Suzanne buy?
I need help on number 19-22......
identify the strategy that writers might use while editing
Help please and fast show work please
how do you say "me" in german
What is chicken hong sue?
Help me please pretty please