farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

Which characteristic is shared by all four cells ?

Why does spatial inequality exist In urban areas

what does it mean if there are two different alleles for a trait?

A worker at a clothing company uses 200 buttons to make 50 shirts.At this rate, how many buttons would the worker use to make 350 shirts ?

why did the heat treated enzyme behave differently than the non heated enzyme

Infer whether species diversity increases or decreases after a fire on a grassland. explain your response.

Find the best word to complete the sentence. 5. Although Frida Kahlo's paintings did not achieve commercial success during her lifetime, near the end of the 20t

what is 1024 to the negative 1/5 power ?

A potter forms a piece of clay into a cylinder. as he rolls it, the length L, of the cylinder increases and the radius, r, decreases. If the length of the cylin

Solve the equation. x – 2/7 = 3 A. x = –3 2/7 B. x = –2 5/4 C. x = 2 5/7 D. x = 3 2/7