sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

Dried foods were most common in Cool, wet climates FrozenArctic climates Hot, dry climates Hot, wet clinates

Fill in the blanks to solve the word problem.

Enter the midpoint of the segment whose endpoints are (6, 5) and (−4, 12).

Giving brainlist easy math problem!

The difference between a number x and 12 is 16?

Pllllsss helppp plsss helppp ASAP plsss helpp

4. What is the solution to the equation below? 1/3x + 6 = 9

Please answer this the best

what was the America freedom train?

please i need help rn